AOBPreview originally published online on February 29, 2008
Annals of Botany 2008 101(7):997-1005; doi:10.1093/aob/mcn028
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Identification of a Chemically Induced Point Mutation Mediating Herbicide Tolerance in Annual Medics (Medicago spp.)
South Australian Research and Development Institute, Waite Campus, Urrbrae, SA 5064, Australia
* For correspondence. E-mail oldach.klaus{at}saugov.sa.gov.au
Received: 29 November 2007 Returned for revision: 21 January 2008 Accepted: 4 February 2008 Published electronically: 29 February 2008
| ABSTRACT |
|---|
|
|
|---|
Background and Aims: Sulfonylurea (SU) herbicides are used extensively in cereal–livestock farming zones as effective and cheap herbicides with useful levels of residual activity. These residues can persist beyond the cropping year, severely affecting legumes in general, and annual medics in particular, resulting in reduced dry matter production, lower seed yields and decreased nitrogen fixation. A strand medic cultivar, Medicago littoralis Angel, has been developed via chemical mutagenesis with tolerance to SU soil residues. Identifying the molecular basis of the observed tolerance was the aim of this study.
Methods: Two F2 populations were generated from crosses between Angel and varieties of intolerant M. truncatula, the male-sterile mutant tap and the cultivar Caliph. Genetic mapping with SSR (single sequence repeat) and gene-based markers allowed identification of the trait-defining gene. Quantitative gene expression studies showed the activity of the respective alleles.
Key Results: Segregation ratios indicated the control of SU-herbicide tolerance by a single dominant gene. SU herbicides inhibit the biosynthesis of the branched-chain amino acids by targeting the acetolactate synthase enzyme, allowing the choice of a mapping approach using acetolactate synthase (ALS) gene homologues as candidates. SSR-marker analysis suggested the ALS-gene homologue on chromosome 3 in M. truncatula. The ALS-gene sequences from Angel and intolerant genotypes were sequenced. In Angel, a single point mutation from C to T translating into an amino acid change from proline to leucine was identified. The polymorphism was used to develop a diagnostic marker for the tolerance trait. Expression of the mutant ALS allele was confirmed by quantitative RT-PCR and showed no differences at various seedling stages and treatments to the corresponding wild-type allele.
Conclusions: The identification of the trait-defining gene and the development of a diagnostic marker enable efficient introgression of this economically important trait in annual medic improvement programs.
Key words: Medicago spp., SU-herbicide tolerance, metsulfuron-methyl, triasulfuron, mutagenesis, acetolactate synthase, genetic analysis, CAPS marker
| INTRODUCTION |
|---|
|
|
|---|
Sulfonylurea (SU) herbicides (chlorosulfuron, metsulfuron-methyl and triasulfuron) are used extensively in the cereal cropping zones of southern Australia and elsewhere in the world. These herbicides are cheap, effective against a wide spectrum of weeds at low rates of application (10–40 g ha–1) and also safe (Sarmah et al., 1998). However, breakdown of SU herbicides in alkaline soils is very slow due to reduced microbial and chemical hydrolysis and hence they persist in these soils, causing damage to following sensitive crops (Stork, 1995; Anderson et al., 2004). Many soil types in southern Australia are alkaline in nature. Annual medics (Medicago spp.), commonly grown in crop rotations with cereals, are well adapted to these soils. However, different studies have shown that the growth of annual medics in cereal rotations is restricted due to SU-herbicide residues (Noy, 1996; Wilhelm and Hollaway, 1998). Heap (2000) developed a strand medic (M. littoralis) Angel by ethyl methanesulfonate (EMS) mutagenesis that has been proven to be tolerant to soil residues of SU herbicides (Howie et al., 2002; Howie, 2004).
SU herbicides are suggested to inhibit the activity of acetolactate synthase (ALS, EC 2·2·1·6) through binding to a quinone-binding site (Schloss et al., 1988). Inhibition of ALS prevents the biosynthesis of the essential branched-chain amino acids valine, leucine and isoleucine (Bauerle et al., 1964). Resistances to SU herbicides have been identified in ALS proteins with substitutions in one or more of six conserved amino acids, Ala122, Pro197, Ala205, Trp574, Ser653 (Tranel and Wright, 2002) and, more recently, Asp376 (Whaley et al., 2007), with positions according to the ALS precursor protein in Arabidopsis.
The ability to identify the molecular basis of economically important traits in Medicago species has been greatly improved through the availability of molecular resources such as genetic maps, expressed sequence tags and a first draft of the sequenced genome of Medicago truncatula (barrel medic, http://www.medicago.org/genome; Frugoli and Harris, 2001). Manual crossing, which allows hybridization between different species of annual medics(Pathipanawat et al., 1994) was used in this study to produce two large segregating populations between Angel and two SU-herbicide intolerant barrel medics. These populations were phenotyped under different growing regimes in order to mimic field conditions.
The present study was undertaken with the objective of understanding the nature of inheritance and the molecular basis of the SU herbicide tolerance trait in the cultivar Angel.
| MATERIAL AND METHODS |
|---|
|
|
|---|
Inheritance study
In order to study the genetics of the SU-herbicide tolerance trait in Medicago littoralis Rhode ex Loisel. Angel, two populations were developed:
- M. truncatula Gaertn., male sterile mutant, tap (derived from EMS mutant of A17, the genotype used for M. truncatula genome sequencing; Penmetsa and Cook, 2000) x Angel;
- Toreador, an annual medic hybrid cultivar [M. tornata (L.) Mill. x M. littoralis Loisel.) x Angel.
Phenotyping
Foliar method
Germinated seeds were transplanted into seedling trays with University of California (UC) mix (size of the tray: 28 x 33 cm, which contained 6 x 8 = 48 cells; dimension of each cell: 3·5 x 4 x 4 cm). For each seedling tray, one row of eight was planted with Angel and one row planted with the intolerant parent. The allocation of the parents and the population to be tested was at random. The temperature in the glasshouse was maintained at 18–20°C. Two trifoliates were sampled from the plants for molecular analysis when they had produced about three trifoliates. The plants were allowed to recover after sampling and then sprayed with triasulfuron at a rate of 7·5 g ha–1 active ingredient. The plants were scored for SU damage 3 weeks after spraying. The scoring was done on a 1–5 scale, as follows:
- leaves all green;
- one to two leaves yellow;
- most leaves yellow and may be turning red;
- all leaves yellow or red and plant is generally necrotic;
- whole plant very necrotic or is dead.
3 were considered to be sensitive.
Soil method
Germinated seeds were planted into seedling trays (similar dimensions as described above) with UC mix that had been sprayed with metsulfuron-methyl at a rate of 1·125 g ha–1 of product. The temperature in the glasshouse was maintained at 18–20°C. The plants were scored on a 0–5 scale as outlined below:
- (0) cotyledons only;
- (1) cotyledons and very stunted spade leaf;
- (2) cotyledons and small spade leaf (about 50 % normal size);
- (3) cotyledons and good-size spade leaf;
- (4) cotyledons, good-size spade leaf and one trifoliate;
- (5) cotyledons, good-size spade leaf and two trifoliates.
- (1) cotyledons and very stunted spade leaf;
Genetic analysis of herbicide tolerance
In order to map the SU-herbicide tolerance gene, backcross populations with Angel using M. truncatula genotypes tap and Caliph as the recurrent parent were developed. Manual hybridization procedures were carried out as described by Pathipanawat et al. (1994) and Penmetsa and Cook (2000). More than 300 hundred plants of each of the two-backcross populations and parents were utilized for the SU-herbicide screening (Table 1).
|
Leaf samples were freeze-dried prior to DNA extraction according to Rogowsky et al. (1991) with modifications as reported by Williams et al. (2003). For PCR analysis with SSR primers (Table 2), 10-µL reactions were carried out consisting of approx. 50 ng DNA, 0·25 units Taq DNA polymerase (QIAGEN, VIC, Australia), 1 x Taq buffer, 1·5 mM MgCl2, 0·2 mM of each dNTP, 0·2 µM of each primer. After an initial denaturing step at 95 °C for 2 min, 38 cycles followed with 94 °C for 30 s; 55 °C for 30 s; 72°C for 60 s, with a single final step at 72 °C for 5 min, before allowing cooling to room temperature. Products were separated on 2 % agarose gels. For CAPS marker analysis, primers CAngF (5'GCACCCTCCTTTCCCTAAA3') and CAngR (5'CAAACCGCTTCAATTCATCA3') were used at an annealing temperature of 60 °C. Following PCR, 5 µL of products were exposed to Hpy188III restriction for 3 h according to the manufacturer's protocol (NEB, MA, USA), separated on an 8 % polyacrylamide gel and visualized with ethidium bromide.
|
For sequencing of PCR products, BigDye3·1 sequencing reaction mix (Applied Biosystems, CA, USA) was used according to the manufacturer's instructions. The position of sequencing primers and their sequence are given in a supplementary figure and supplementary table available online. Sequences were determined by an ABI 3700 sequencer and analysed using the Vector NTI software package (Invitrogen, USA). Sequences of the ALS genes were submitted to the NCBI database under the following accession numbers: ALSAngel (EU292213 [GenBank] ), ALSHerald (EU292214 [GenBank] ), ALStap (EU292215 [GenBank] , identical to the Medicago truncatula genomic clone, BAC CT010521 [GenBank] ) and ALSCaliph (EU292216 [GenBank] ).
Gene expression analysis using quantitative real-time RT-PCR (qPCR)
Leaf samples (6–10 leaves) of 8- and 20-d-old seedlings were harvested 48 h after SU-herbicide treatment and from control plants grown under the same conditions without spraying. Samples were snap-frozen in liquid nitrogen before grinding with mortar and pestle. Aliquots of 100 mg each were weighed out and used for total RNA extraction according to the manufacturer's protocol (TriReagent, MRC, OH, USA). After DNase I treatment (DNA-free, Ambion, Austin, TX, USA), 5 µL (about 3 µg) of total RNA was used for single-strand cDNA synthesis according to the manufacturer's protocol (Superscript III, Invitrogen, VIC, Australia). Two microliters of a 1-in-20 diluted cDNA served as template for each qPCR reaction. All qPCR reactions were carried out three times with each sample being measured in duplicate in every qPCR run. Non-template controls were used to account for potential contaminations. Transcript levels (CT values) of the ALS gene were normalized to the CT value of a tubulin gene (TC106434; forward primer 5'CCTGTTGCCGGTTCATAATC3'; reverse primer: 5'CCCAAACATAGATTGCTGCTT3') as suggested by Edwards et al. (2006). PCR conditions were as for the ALS gene. Eight microliter qPCR reactions were carried out using iQTM SYBR® Green Supermix (BIORAD, CA, USA) according to the manufacturer's instructions. For amplification of both ALS1 alleles (wild-type and mutant) primers Als.qF1 (5'CGGCCGGAAGTTGCAAGGAA3') and Als.qR1 (5'TCGCCGATGCTTTGATGGACAG3') were used at the following cycling conditions: 1 x 95 °C for 3 min, 35 x (95 °C for 20 s, 60 °C for 30 s, 72 °C for 30 s), with a final measurement of the PCR-product's melt profile from 65 °C to 99 °C. Significance of differences in expression levels between the analysed cultivars (Caliph, Herald, Angel) and their treatments was determined using Student's t-test with a significance level P = 0·05.
Expression of the ALS mutant allele was confirmed by Hpy188III restriction analysis, as described for genomic DNA analysis, and subsequent separation on an 8 % denaturing polyacrylamide gel with visualizing using ethidium bromide.
| RESULTS |
|---|
|
|
|---|
Inheritance study
All the F1 plants in the cross between tap and Angel were SU-herbicide tolerant, and showed similar growth to the tolerant parent, Angel. The results of the phenotyping data are presented in Table 1. The segregation ratios in the F2 population in the cross between Toreador and Angel gave a good fit to the 3:1 (tolerant vs. intolerant) ratio expected from a single dominant gene. Some F3 families were homozygous tolerant while others showed a 3:1 ratio for the tolerance trait (data not shown). These results were further confirmed by the good fit to the 3:1 ratio obtained in the backcross F2 populations. During phenotyping, plants that could not be allocated into any of the two classes, tolerant or intolerant, were not included in the chi-square analysis.
Genetic analysis using SSR markers
The known genomic sequence of the ALS gene from Arabidopsis CSR1 (Acc. NM_114714
[GenBank]
) was used to query the Medicago non-redundant database. Two homologous sequences were found in the Medicago truncatula genome, located on chromosomes 2 and 3, showing 74 % and 76 % identity to the Arabidopsis gene sequence, respectively.
With the help of the Medicago consortium database (http://www.medicago.org/genome/), the corresponding BAC contigs (MTCON53 and MTCON341) were used to select known SSR markers in proximity to the ALS gene homologues. Seventeen SSR markers with known genomic positions were initially tested for polymorphisms on the four parents. Subsequently, polymorphic SSR markers were used to analyse DNA samples of 12 herbicide-tolerant (score 1) and intolerant (score 5) lines per F2 population and sowing date, a total of 96 F2 lines. Each population was sown twice on different dates, sprayed with herbicide and scored. The four polymorphic SSR markers for the cross tap x Angel and seven markers for the cross Caliph x Angel indicated good linkage (between zero and three recombinants within 48 F2 plants) between the herbicide-tolerance trait and the locus of BAC contig MTCON341 at 70·3 cM on chromosome 3 (http://www.medicago.org/genome/; Table 2).
Development of a diagnostic marker to the ALS1 mutant gene
Primers were designed for full-length isolation and sequencing of the ALS gene homologue on Mt chromosome 3 (BAC CT010521
[GenBank]
; see supplementary table, available online). The genomic full-length sequence of the chromosome 3 ALS gene homologue was amplified from the parents of the crosses, Angel, tap and Caliph, as well as from the strand medic cultivar Herald that was originally used to generate Angel via chemical mutagenesis. The position and orientation of the primers used for amplification and sequencing is indicated in the supplementary figure (available online).
Within 2051 bp, which includes a complete open reading frame, 25 single nucleotide polymorphisms (SNPs) between the two species, barrel medics (M. truncatula: tap and Caliph) and strand medics (M. littoralis: Herald and Angel), were identified. Only one SNP was detectable among the two barrel medics and another single SNP between Angel and Herald at position 533 bp within the open reading frame of 1953 bp (Fig. 1A). The substitution of C by T translated into an amino acid (aa) change at position 179 from proline (CCC) to leucine (CTC) in the 651-aa long precursor ALS protein sequence (Fig. 1B). Position Pro179 in the Medicago protein corresponds to position Pro197 of the ALS precursor protein in Arabidopsis (NP_190425 [GenBank] , 670 aa).
|
For marker development, the base-pair difference at position 533 bp was screened for restriction length polymorphisms. Restriction enzyme Hpy188III (TCNNGA) was found to restrict the mutant allele present in Angel. Thus, a CAPS (cleaved amplified polymorphic sequence) marker could be developed by amplifying an 857-bp fragment with primers CAngF/R and subsequent restriction with Hpy188III, generating an alternative restriction pattern in Angel (323 bp, 285 bp, 164 bp, 57 bp, 28 bp) compared with Herald, tap and Caliph (323 bp, 285 bp, 192 bp, 57 bp; Fig. 2).
|
The allele-specific CAPS marker CAng was used to genotype a total of 623 F2 plants in both populations that were sown and screened on three different dates; 302 F2 plants of tap x Angel and 321 F2 plants of Caliph x Angel. About two-thirds of plants in each population were phenotyped using the foliar method and 186 plants by using the soil method (Table 3).
|
The correlation between the ALS1-specific CAPS marker CAng and the SU-herbicide tolerant phenotype was observed in 94 % of the 623 F2 plants analysed from both populations in three foliar-method assays. The co-dominant marker CAng was able to detect homozygous and heterozygous genotypes (Fig. 3). It was noticed that between 6 and 12% of the plants in the Caliph x Angel population carrying the mutant allele appeared intolerant. Only 4 to 6 % of F2 plants of the tap x Angel population showed discrepancies between genotype and phenotype in the foliar assay. Perfect linkage between CAng and the SU-tolerance trait was found when F2 plants of tap x Angel were phenotyped with the soil method, which mimics the situation in the field with residues of SU herbicides present in the soil.
|
The mutant ALS gene is expressed
Quantitative real-time RT-PCR (qPCR) was carried out to verify the expression of the mutant ALS allele in Angel. Leaf samples were harvested for RNA extraction from 8- and 20-d-old seedlings of cultivars Angel, Herald and Caliph, either without or 48 h after SU-herbicide spray treatment, which is about 10 d before symptoms become visible in intolerant plants. After cDNA synthesis, relative transcript levels were measured by qPCR amplifying of a 202-bp fragment comprising the point mutation within the ALS1 gene on chromosome 3 (Fig. 4A). Expression of the single ALS gene-specific PCR product, as indicated by the meltcurve of the qPCR product (data not shown), was detectable in all samples. No significant differences in expression levels were detected when comparing the 8- and 20-d-old seedlings of the control groups, based on Student's t-test. Neither were there significant differences between the 8- and 20-d-old seedlings after treatment with SU-herbicide, apart from in the barrel medic Caliph. However, significantly lower ALS gene transcript levels were observed in SU-treated compared with untreated seedlings of corresponding developmental stages; the expression levels after herbicide treatment were between 30–40 % of those in the control group of the corresponding seedling age. The exception was for 8-d-old seedlings of Caliph, which showed no significant difference between control groups and seedlings treated with herbicide (Fig. 4A). The overall averaged expression level of the ALS gene was about 1/13th that of the tubulin gene (data not shown).
|
For verification that Angel is indeed expressing the mutant ALS allele, the generated qPCR products from control and herbicide-treated 20-d-old seedlings of all three genotypes were exposed to Hpy188III and subsequently separated on an 8 % denaturing polyacrylamide gel (Fig. 4B). The alternative restriction pattern of the qPCR products of Angel (61 bp, 57 bp, 54 bp, and 30 bp) compared to Herald and Caliph (84 bp, 61 bp and 57 bp) confirmed that the mutant ALS allele containing the Hpy188III restriction site was expressed in the herbicide-tolerant cultivar.
| DISCUSSION |
|---|
|
|
|---|
SU herbicides have been very effective in the control of a broad range of weeds in cereal cropping zones. However, these herbicides accumulate in alkaline soils due to a lack of organic matter and low biological activity (Sarmah et al., 1998). This accumulation results in greatly reduced growth of legumes and oilseed crops grown in rotations (Stork, 1995; Walker et al., 2000; Anderson et al., 2004). Legumes and oilseed crops are sensitive to levels as low as 0·5 parts per billion, or less than 5 % of the recommended rates for weed control (Stork, 1995; Wilhelm and Hollaway, 1998). The negative effect of these residues on symbiotic nitrogen fixation has also been documented (Anderson et al., 2004). The strand medic mutant Angel developed via chemical mutagenesis has already demonstrated its value by its excellent field performance in the presence of SU-herbicide residues. Field-testing in the presence of triasulfuron residues has shown that Angel achieves higher dry matter production and seed set compared to its parent cultivar, Herald (Howie and Bell, 2005; Bell et al., 2005a). The tolerance of Angel to SU herbicides gives it a competitive edge over the common weeds in both the establishment and regenerating growth phases.
Since the 1980s, when ALS was described as being the target of different herbicides (Schloss et al., 1988), herbicide-tolerant mutant proteins have been investigated intensively. ALS alleles encoding herbicide-tolerant proteins have been utilized in biotechnology research to select genetically transformed plant tissue during in vitro culture steps. Early reports described mutant ALS alleles from Arabidopsis transformed into tobacco (Haughn et al., 1988; Gabard et al., 1989) and canola (Miki et al., 1990). More recently, ALS alleles with multiple mutations have been deployed as selectable markers that allow more stringent in vitro selection, e.g. as shown for oilseed mustard (Ray et al., 2004) and rice (Osakabe et al., 2005). Herbicide tolerance is desirable in agricultural production systems as well as in vitro culture. Grass species such as ryegrass can have a naturally high rate of resistant individuals (between 1/8000 to 1/45 000), indicating that resistances to herbicides are common (Preston and Powles, 2002). Currently there are 95 weed species reported to show levels of resistance to herbicides that inhibit the ALS enzyme (Heap, 2007). Therefore, crop plants that carry multiple resistances through modification of a single gene or combinations of different herbicide-tolerance mechanisms are seen as possible approaches in current and future weed management (Green, 2007).
The mode of inheritance of tolerance to ALS-inhibiting herbicides has been reported to be due to a single, dominant nuclear-gene mutation in some species (Mourad et al., 1993; Lee and Owen, 2000; Van Eerd et al., 2004), and due to a single, partially dominant gene in others (Boutsalis and Powles, 1995; Kolkman et al., 2004). In the present study, the similar performance of the F1 plants compared to the tolerant parent, Angel, and the segregation ratios observed in the F2, F3 and backcross populations clearly showed that the tolerance to ALS herbicides derived from Angel is due to a single dominant gene. In addition, the percentage of the plants in the F2 and backcross populations that could not be classified as tolerant or intolerant during phenotyping was very low (<3 %), which also gave us confidence to dismiss the partial-dominance mode of inheritance.
The described mutations in the ALS gene leading to SU-herbicide tolerance in various plant species allowed us to hypothesize it as being the possible molecular basis for the tolerance observed in Angel. Screening the M. truncatula genome sequence draft with the Arabidopsis ALS gene sequence CSR1 revealed two homologous sequences located on chromosomes 2 and 3. Linkage between the herbicide-tolerant phenotype and known SSR markers that are positioned close to the ALS homologue on chromosome 3 was established through the analysis of 96 segregant lines (phenotypic scores 1 and 5 only) of the two F2 populations (Table 2).
Subsequent comparisons of the genomic sequences of the ALS gene of the herbicide-intolerant genotypes tap, Caliph and Herald and the tolerant Angel revealed numerous SNPs (25) between the two species M. truncatula and M. littoralis, but only a single C-to-T substitution between Angel and its intolerant predecessor Herald. Substitutions leading from C to T caused by EMS treatment represent over 99 % of reported point mutations (Greene et al., 2003) and are the likely cause of this SNP between Angel and Herald.
The substitution is translated into an amino acid (aa) change from proline to leucine at position 179 in the 651-aa long precursor ALS protein sequence. Aligned to the Arabidopsis ALS protein CSR1, position P179 in medics (P179 in Herald and L179 in Angel) corresponds to position P197 in the slightly longer Arabidopsis protein of 670 aa, which is generally used as a reference sequence. An amino acid change at this position is amongst the most commonly reported, together with the changes described at Ala122, Ala205, Trp574, and Ser653 (Tranel and Wright, 2002; Tan et al., 2005). Not all of these mutations result in the same level and profile of herbicide tolerance. For example, mutations that change Pro197 cause good tolerance to sulfonylurea herbicides but no, or only low, tolerance to the ALS-inhibiting herbicides based on imidazolinones (Tan et al., 2005). Research is in progress to assess the tolerance of Angel to other classes of Group B herbicides, such as the sulfonamides and imidazolinones. Field studies have demonstrated that Angel can be successfully controlled as a component of crop rotation in the cropping phase by a range of commonly used herbicides, including 2,4-D amine, MCPA (2-methyl-4-chlorophenoxyacetic acid), bromoxynil and dicamba (Bell et al., 2005b).
The point mutation in the Angel ALS allele was used to develop a diagnostic marker in the form of a CAPS marker (CAng). Two segregating F2 populations were generated, by crossing intolerant barrel medic genotypes tap and Caliph each with Angel. In total, over 600 F2 individuals were phenotyped by employing two herbicide application methods, foliar spray and soil treatment (Table 3). The co-dominant marker (Fig. 3) showed an overall linkage of 94 % to the tolerance trait assayed by both foliar and soil methods. A linkage of 100 % was observed with F2 plants of the population tap x Angel after application of the herbicide in the soil. The latter application method most closely mimics the situation in the field, where soil residues hinder normal seedling growth. Individuals of population Caliph x Angel showed an overall lower linkage than those of tap x Angel. Interestingly, most of the individuals that had no linkage between phenotype and genotype carried the resistant allele but showed the intolerant phenotype (36 out of 42 lines within 623 F2 plants; Table 3). This could be attributed to misclassification errors due to poor vigour of some of the plants in the Caliph x Angel backcross population (see also Materials and Methods).
Bioassays are valuable in characterizing the risk of injury to the following season's crop by SU herbicides. In this study we have used both foliar and soil application of herbicides to simulate the residue levels under field conditions. The foliar method was used as the routine bioassay as it enabled us to collect the leaf samples for laboratory analysis for molecular characterization, before the application of herbicide. The soil method closely mimics the situation in the field and allows standardizing of the herbicide effect, whereas in the field, soil pH, temperature and organic matter content can greatly influence the longevity and effect of these herbicides (Sarmah et al., 1998).
Importantly, the mutant allele is also expressed in Angel, as shown by quantitative real-time RT-PCR. The mutation does not seem to have an impact on the gene expression level, as the wild-type allele in Herald (the progenitor of Angel) and the mutant allele in Angel show an identical expression pattern in young or older seedlings, irrespective of herbicide or no treatment (Fig. 4A). A change in expression due to the identified point mutation was neither expected nor reported previously, as the mutation in Pro197 reduces the sensitivity of ALS and is a post-translational effect.
The primers used for ALS-allele amplification in qPCR were specific. Nevertheless, restriction of the PCR products utilizing the polymorphic Hpy188III restriction site was used to show that the wild-type ALS allele is expressed in the intolerant Caliph and Herald, whereas in Angel the mutant allele with an additional restriction site is transcribed (Fig. 4B). Expression analysis further indicated that ALS gene expression was significantly lower in the group of plants treated with herbicide compared with the control groups. The levels were reduced in the same way in Herald and Angel in 8- and 20-d-old seedlings. In 8-d-old seedlings of Caliph ALS gene expression was comparable between control plants and plants treated with herbicide; only the 20-d-old seedlings of this cultivar showed a reduced ALS gene expression upon herbicide treatment. A change in transcript level upon herbicide treatment that varies between species is not surprising. Numerous differentially expressed genes have been discovered amongst biotypes of the same species upon herbicide treatment (Kern et al., 2005). A maintained expression level in the 8-d-old seedlings of Caliph does not mediate herbicide tolerance; phenotypic screening of our populations demonstrated that parental lines of Caliph were highly intolerant. Studies in transgenic plants support the assumption that a high expression level of a wild-type ALS allele is unlikely to significantly increase tolerance to SU-herbicides. Odell et al. (1990) constitutively expressed the Arabidopsis wild-type ALS allele in tobacco and although ALS transcript levels were up-regulated over 25-fold, ALS enzyme activity increased at most twofold, and the increase in tolerance was equally small. In contrast, the constitutive expression of an ALS mutant allele was needed to drastically increase herbicide tolerance in the transgenic tobacco plants (Odell et al., 1990). Hence, it is not surprising that the maintained expression level upon herbicide treatment in 8-d-old seedlings of Caliph does not provide herbicide tolerance.
To our knowledge, this is the first report of molecular characterization of the trait for tolerance to SU-herbicide in annual Medicago spp. We have employed genetic and genomic tools derived from M. truncatula to understand this trait in a commercialized pasture legume cultivar. The developed diagnostic marker can be used to quickly verify the SU-herbicide trait in other annual medic species derived from crosses or hybridization with Angel, especially when breeding for multiple traits.
| SUPPLEMENTARY INFORMATION |
|---|
|
|
|---|
Supplementary information is available online at http://aob.oxfordjournals.org/ and consists of a figure illustrating the relative position of sequencing primers along the genomic ALS gene sequence, and a table listing the primers used for full-length isolation and sequencing of the ALS gene.
| ACKNOWLEDGEMENTS |
|---|
|
|
|---|
We thank Jeff Hill, Steve Robinson and Greg Naglis for their valuable technical assistance, Chris Preston, University of Adelaide for his help in the herbicide application, and Geoff Auricht, SARDI Pasture Group leader for his support of this study. Klaus Oldach and Kevin Williams are affiliates of the University of Adelaide. Douglas Cook and Varma Penmetsa, University of California, Davis, kindly provided seed of the tap plants.
| LITERATURE CITED |
|---|
|
|
|---|
-
Anderson A, Baldock JA, Rogers SL, Belotti W, Gill G. Influence of chlorsulfuron on rhizobial growth, nodule formation and nitrogen fixation with chickpea. Australian Journal of Agricultural Research (2004) 55:1059–1070.[CrossRef][Web of Science]
Bauerle RH, Freundlich M, Størmer FC, Umbarger HE. Control of isoleucine, valine and leucine biosynthesis. II. Endproduct inhibition by valine of acetohydroxy acid synthetase in Salmonella typhimurium. Biochimica et Biophysica Acta (1964) 92:142–149.[Medline]
Bell C, Howie J, Ward B, Sly R. Angel survives summer SU residues. In: Eyre Peninsula farming systems 2005 summary (2005) a. Minnipa, South Australia: South Australian Research and Development Institute. 51–52.
Bell C, Howie J, Sly R. Controlling Angel strand medic in crop. In: Eyre Peninsula farming systems 2005 summary (2005) b. Minnipa, South Australia: South Australian Research and Development Institute. 52–54.
Boutsalis P, Powles SB. Inheritance and mechanism of resistance to herbicides inhibiting acetolactate synthase in Sonchus oleraceus L. Theoretical and Applied Genetics (1995) 91:242–247.[Web of Science]
Edwards O, Klingler J, Gao L, Korth K, Singh K. Medicago truncatula interaction with insects. In: Medicago truncatula handbook (2006) Ardmore, OK: Samuel Roberts Noble Foundation. http://www.noble.org/MedicagoHandbook/; accessed October 2007.
Frugoli J, Harris J. Medicago truncatula on the move! The Plant Cell (2001) 13:458–463.
Gabard JM, Charest PJ, Iyer VN, Miki BL. Cross-resistance to short residual sulfonylurea herbicides in transgenic tobacco plants. Plant Physiology (1989) 91:574–580.
Green JM. Review of glyphosate and ALS-inhibiting herbicide crop resistance and resistant weed management. Weed Technology (2007) 21:547–558.[CrossRef][Web of Science]
Greene EA, Codomo CA, Taylor NE, Henikoff JG, Till BJ, Reynolds SH, et al. Spectrum of chemically induced mutations from a large-scale reverse-genetic screen in Arabidopsis. Genetics (2003) 164:731–740.
Haughn GW, Smith J, Mazur B, Somerville C. Transformation with a mutant Arabidopsis aeetolactate synthase gene renders tobacco resistant to suIfonylurea herbicides. Molecular and General Genetics (1988) 211:266–271.[CrossRef]
Heap I. International survey of herbicide-resistant weeds (2007) WeedScience.org. http://www.weedscience.org/summary/MOASummary.asp; accessed Oct. 2007.
Heap J. Increasing Medicago resistance to soil residues of ALS-inhibiting herbicides. (2000) Australia: University of Adelaide. PhD thesis.
Howie J. Strand medic. Plant Varieties Journal, Medicago littoralis FEH-1 (2004) 17:453–455.
Howie JH, Bell CA. Field performance of an annual medic tolerant of sulfonylurea herbicide residues. O'Mara FP, Wilkins RJ, Mannetje L, Lovett DK, Rogers PAM, Boland TM, eds. (2005) XX International Grassland Conference: offered papers. Wageningen. Wageningen Academic Publisher, 413.
Howie JH, Heap J, Preston C, Nair RM. Development of an annual medic tolerant of sulfonylurea herbicide residues. Plant Breeding for the 11th Millennium. McComb JA, ed. (2002) September. Proceedings of the 12th Australasian Plant Breeding Conference, 15–20th: Perth, W. Australia, The Australasian Plant Breeding Association Inc. 767–769.
Kern AJ, Chaverra ME, Cranston HJ, Dyer WE. Dicamba-responsive genes in herbicide-resistant and susceptible biotypes of kochia (Kochia scoparia). Weed Science (2005) 53:139–145.[CrossRef][Web of Science]
Kolkman JM, Slabaugh MB, Bruniard JM, Berry S, Bushman BS, Olungu C, et al. Acetohydroxyacid synthase mutations conferring resistance to imidazolinone or sulfonylurea herbicides in sunflower. Theoretical and Applied Genetics (2004) 109:1147–1159.[CrossRef][Web of Science][Medline]
Lee JM, Owen MDK. Comparison of acetolactate synthase enzyme inhibition among resistant and susceptible Xanthium strumarium biotypes. Weed Science (2000) 48:286–290.[CrossRef][Web of Science]
Miki BL, Labbé H, Hattori J, Ouellet T, Gabard J, Sunohara G, Charest PJ, Iyer VN. Transformation of Brassica napus canola cultivars with Arabidopsis thaliana acetohydroxyacid synthase genes and analysis of herbicide resistance. Theoretical and Applied Genetics (1990) 80:449–458.[Web of Science]
Mourad G, Pandey B, King J. Isolation and genetic analysis of a triazolopyrimidine-resistant mutant of Arabidopsis. Journal of Heredity (1993) 84:91–96.
Noy DM. Persistence of sulfonylureas on alkaline soils in south-eastern Australia and the potential damage to subsequent crops and pastures. (1996) Proceedings of 11th Australian Weeds Conference. Melbourne: Weed Science Society of Victoria Inc. 42–44.
Odell JT, Caimi PG, Yadav NS, Mauvais CJ. Comparison of increased expression of wild-type and herbicide-resistant acetolactate synthase genes in transgenic plants, and indication of post-transcriptional limitation on enzyme activity. Plant Physiology (1990) 94:1647–1654.
Osakabe K, Endo M, Kawai K, Nishizawa Y, Ono K, Abe K, et al. The mutant form of acetolactate synthase genomic DNA from rice is an efficient selectable marker for genetic transformation. Molecular Breeding (2005) 16:313–320.[CrossRef][Web of Science]
Pathipanawat W, Jones RAC, Sivasithamparam K. An improved method for artificial hybridization in annual Medicago species. Australian Journal of Agricultural Research (1994) 45:1329–1335.[CrossRef][Web of Science]
Penmetsa RV, Cook DR. Production and characterization of diverse developmental mutants of Medicago truncatula. Plant Physiology (2000) 123:1387–1397.
Preston C, Powles SB. Evolution of herbicide resistance in weeds: initial frequency of target site-based resistance to acetolactate synthase-inhibiting herbicides in Lolium rigidum. Journal of Heredity (2002) 88:8–13.[CrossRef]
Ray K, Jagannath A, Arora S, Gangwani SA, Burma PK, Pental D. Mutant acetolactate synthase gene is an efficient in vitro selectable marker for the genetic transformation of Brassica juncea (oilseed mustard). Journal of Plant Physiology (2004) 161:1079–1083.[CrossRef][Web of Science][Medline]
Rogowsky PM, Guider FLY, Langridge P, Shepherd KW, Koebner RMD. Isolation and characterization of wheat–rye recombinants involving chromosome arm 1DS of wheat. Theoretical and Applied Genetics (1991) 82:537–544.[Web of Science]
Sarmah AK, Kookana RS, Alston AM. Fate and behaviour of triasulfuron, metsulfuron-methyl, and cholrsulfuron in the Australian soil environment: a review. Australian Journal of Agricultural Research (1998) 49:775–790.[CrossRef][Web of Science]
Schloss JV, Ciskanik LM, Van Dyk DE. Origin of the herbicide binding site of acetolactate synthase. Nature (1988) 331:360–362.[CrossRef]
Stork PR. Field leaching and degradation of soil applied herbicides in a gradationally textured alkaline soil: chorosulfuron and triasulfuron. Australian Journal of Agricultural Research (1995) 46:1445–1458.[CrossRef][Web of Science]
Tan S, Evans RR, Dahmer ML, Singh BK, Shaner DL. Imidazolinone-tolerant crops: history, current status and future. Pest Management Science (2005) 61:246–257.[CrossRef][Web of Science][Medline]
Tranel PJ, Wright TR. Resistance of weeds to ALS-inhibiting herbicides: what have we learned? Weed Science (2002) 50:700–712.[CrossRef][Web of Science]
Van Eerd LL, McLean MD, Stephenson GR, Hall JC. Resistance to quinclorac and ALS-inhibitor herbicides in Galium spurium is conferred by two distinct genes. Weed Research (2004) 44:355–365.[CrossRef][Web of Science]
Walker SR, Barnes JE, Osten VA, Churchett JD, McCosker M. Crop responses to sulfonylurea residues in soils of the subtropical grain region of Australia. Australian Journal of Agricultural Research (2000) 51:587–596.[CrossRef][Web of Science]
Whaley CM, Wilson HP, Westwood JH. A new mutation in plant ALS confers resistance to five classes of ALS-inhibiting herbicides. Weed Science (2007) 55:83–90.[CrossRef][Web of Science]
Wilhelm N, Hollaway K. Persistence of sulfonylurea herbicides on alkaline soils. Michalk D, Kemp D, Dowling P, Kirkegaard J, eds. (1998) Proceedings of the Australian Agronomy Conference. Australian Society of Agronomy. http://www.regional.org.au/au/asa/1998/6/150wilhelm.htm#P1_57.
Williams KJ, Platz GJ, Barr AR, Cheong J, Willsmore K, Cakir M, Wallwork H. A comparison of the genetics of seedling and adult plant resistance to the spot form of net blotch (Pyrenophora teres f. maculata). Australian Journal of Agricultural Research (2003) 54:1387–1394.[CrossRef][Web of Science]
Related articles in Ann Bot:
- ContentSnapshots
Ann Bot 2008 101: NP.[Extract] [Full Text] - John Bryant takes a closer look at some of this month's Original Articles
- J. A. Bryant
Ann Bot 2008 101: NP.[Extract] [Full Text]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


