AOBPreview originally published online on October 21, 2005
Annals of Botany 2005 96(7):1307-1314; doi:10.1093/aob/mci282
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
NADP-Malate Dehydrogenase Gene Evolution in Andropogoneae (Poaceae): Gene Duplication Followed by Sub-functionalization
1 Université de la Réunion, LBGM, 15 Avenue R. Cassin, 97715 St-Denis Messag Cedex 9, La Réunion, France and 2 Department of Ecology and Evolution, Biology Building, University of Lausanne, 1015 Lausanne, Switzerland
* For correspondence. E-mail gbesnar{at}hotmail.com
Received: 22 November 2004 Returned for revision: 18 May 2005 Accepted: 15 September 2005 Published electronically: 21 October 2005
| ABSTRACT |
|---|
|
|
|---|
Background and Aims Plastid NADP-dependent malate dehydrogenase (MDH) catalyses the conversion of oxaloacetate to malate. In C4 plants, it is involved in photosynthetic carbon assimilation. In Poaceae, one NADP-MDH gene has been identified in rice (C3; Erhartoideae) and maize (C4; Panicoideae), whereas two tandemly repeated genes have been identified in Sorghum (C4; Panicoideae). In the present study, the molecular evolution of the NADP-MDH multigene family was investigated in order to analyse how the C4 isoform has evolved over a broader range of panicoid grasses.
Methods Polymerase chain reaction (PCR)-based cloning was used to isolate cDNAs encoding NADP-MDHs from 15 species of Panicoideae. A gene phylogeny was reconstructed based on cDNA sequences using distance and maximum parsimony methods. Episodic selection along some branches of the phylogenetic tree was tested by analysing non-synonymous and synonymous rate ratios.Transcription of NADP-MDH genes was compared in green leaves of five accessions of Saccharum, Sorghum and Vetiveria using a semi-quantitative PCR approach.
Key Results Phylogenetic analyses of these data support the existence of two NADP-MDH gene lineages (NMDH-I and NMDH-II) in several Andropogoneae (i.e. Saccharum, Sorghum and Vetiveria). Episodic positive selection was shown along the basal branch of the NMDH-II clade. Three amino acid modifications allow the two gene lineages to be distinguished, suggesting a positive selection at these sites. In green leaves, we showed that the transcript accumulation was higher for NMDH-I than for NMDH-II.
Conclusions It is hypothesized that the maintenance of both NADP-MDH genes in some Andropogoneae is due to a partition of the original functions across both copies. NMDH-I probably corresponds to the C4 isoform as previously suggested. Nevertheless, some C4 species (e.g. maize) only have one gene which should be selected for its high expression level in leaves. This study confirms that gene duplicates have been recruited for C4 photosynthesis but are not required in every case.
Key words: C4 photosynthesis, gene duplication, multigene family, NADP-MDH, Poaceae, positive selection, sub-functionalization
| INTRODUCTION |
|---|
|
|
|---|
C4 photosynthesis provides a selective advantage for plants growing in tropical areas (Sage, 2004
In plants, plastid NADP-dependent malate dehydrogenases (NADP-MDHs; EC 1.1.1.82
[EC]
) are essential enzymes involved in photosynthesis (Scheibe, 1987
; Sheen, 1999
). These enzymes are implicated in two main functions. First, in all plants, NADP-MDH helps control export of the reducing equivalents (malate) from the chloroplast to the cytosol (Scheibe, 1987
; Ocheretina et al., 2000
). Secondly, NADP-MDH is also involved in photosynthetic carbon assimilation of both C4 NADP-malic enzyme type and C4 phosphoenolpyruvate carboxykinase (PCK) enzyme type plants because it converts oxaloacetate to malate, which is then transferred from the mesophyll cells to the bundle sheath cells (von Caemmerer and Furbank, 2003
). NADP-MDH is a redox-regulated enzyme (Miginiac-Maslow et al., 2000
). Redox regulation appeared relatively late in evolution (probably in green algae; Ocheretina et al., 2000
). NADP-MDH is a highly conserved enzyme in plants, and is apparently encoded by a small multigene family (Luchetta et al., 1991
). Phylogenetic trees based on this gene family should be appropriate for increasing our understanding of the evolution of NADP-MDH isoforms and particularly to study the appearance(s) of the C4 NADP-MDH isoform during plant evolution.
In maize and sorghum, two grasses belonging to tribe Andropogoneae of subfamily Panicoideae (GPWG, 2001
), NADP-MDH genes have been characterized (Metzler et al., 1989
; Luchetta et al., 1991
). Only one NADP-MDH nuclear gene was identified in maize (Metzler et al., 1989
) and in the complete genome sequence of rice (Kikuchi et al., 2003
). Conversely, in sorghum, the existence of two tandemly repeated genes encoding NADP-MDH was demonstrated (Luchetta et al., 1991
). The regulation of the two genes was differential, with one being light induced (C4 gene; NMDH-I) and the other (NMDH-II) being constitutively expressed at a low level. The function of the latter was not clearly elucidated but it could be involved in the export of reducing equivalents. Based on these data, Luchetta et al. (1991)
postulated that the grass C4 NADP-MDH gene could have been derived from a non-C4 NADP-MDH. In contrast, McGonigle and Nelson (1995)
proposed that only changes in the regulation of a pre-existing gene were involved in the C4 NADP-MDH appearance in the genus Flaveria (Asteraceae), without gene duplication during the evolution from C3 to C4 plants. Only a few DNA sequences of NADP-MDH genes are currently available, and consequently the evolution of the NADP-MDH multigene family is still not well understood (Ocheretina et al., 2000
).
In this study, PCR-based cloning was used to isolate cDNAs encoding NADP-MDHs from 15 species belonging to Panicoideae. From green leaves, cDNAs related to the two sorghum isoforms were isolated. A phylogenetic approach was used to provide insights into the evolution of the NADP-MDH multigene family in Panicoideae. Episodic selection along some branches of the phylogenetic tree was tested. In addition, an analysis of transcription specificities of NADP-MDH genes was conducted for three genera of Andropogoneae.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Molecular analysis
In order to isolate cDNA sequences encoding NADP-MDHs in grasses, 15 species belonging to Panicoideae were analysed (Table 1). Twelve are C4 NADP-malic enzyme type plants (representatives of Andropogoneae plus Paspalum paniculatum and Paspalidium geminatum), Urochloa maxima and Melinis repens are C4 PCK enzyme type plants, and Oplismenus compositus is a C3 plant. For each accession, green leaves were sampled at noon. Total RNA was extracted and then reverse transcription reactions were performed as previously described (Besnard et al., 2002
|
From the available NADP-MDH sequences of sorghum [EMBL accessions X53453 [GenBank] (NMDH-I) and S55884 [GenBank] (NMDH-II); Luchetta et al., 1991
were used according to the supplier's recommendations. For each species of Andropogoneae, distinct sequences were looked for among 15 clones using their restriction profile. The insert in each clone was amplified by PCR using SP6 and T7 primers (Promega). PCR products were restricted with HpaII, separated on a 3 % agarose gel and stained with ethidium bromide. Each clone displaying a different profile was then sequenced. Double-stranded DNA sequencing reactions were performed by the ESGS Society (Euro Sequence Gene Service, Evry, France). Sequences have been deposited in the EMBL databank.
Phylogenetic analysis
NADP-MDH cDNA sequences from Sorghum, Zea and Oryza from GenBank were added to the data (Table 1). For Saccharum and Sorghum, both cultivated forms (Saccharum officinarum and Sorghum bicolor) and close wild relatives [Saccharum spontaneum and Sorghum arundinaceum (= S. verticilliflorum)] were studied (Dillon et al., 2001
; Hodkinson et al., 2002
). Only coding sequences (cds) were used for analysis. In addition, the phylogenetic trees were rooted with an outgroup sequence. Since no complete NADP-MDH sequence from another monocot was available in GenBank, a cDNA sequence from Flaveria (U22533
[GenBank]
; Asteraceae) was used. A sample of 25 sequences (Table 1) displaying the major part of the cds was considered. Sequence alignments were performed using Clustal W (Thompson et al., 1994
). Phylogenetic analyses were made using a large internal cDNA segment of 1050 bp in which indels are very infrequent (only one 3 bp deletion was detected in S. spontaneum sequences). In the sorghum sequence X53453
[GenBank]
, the 1050 bp segment is located between nucleotides 220 and 1269. Phylogenetic analyses were conducted using MEGA version 2 (Kumar et al., 2004
). Mean frequencies of each nucleotide were similar (T = 25 %, A = 29 %, G = 26 %, C = 20 %), but transitions were twice as frequent as transversions. Consequently, to consider this unequal probability of the substitution types, the Kimura 2-parameter (Kimura, 1980
) was used to compute distances between each pair of sequences. Phylogenetic trees were then constructed using the neighbour joining algorithm (NJ; Saitou and Nei, 1987
). Bootstrap values were computed using 1000 replicates to evaluate support for the groupings. In addition, a maximum parsimony (MP) analysis was conducted. All characters were equally weighted. Gaps were treated as missing data. A heuristic search was used to find the most-parsimonious trees. The close-neighbour-interchange algorithm was used with a search level of 3 (Kumar et al., 2004
). Searches included 100 replications of random addition sequences. All the best trees were retained. A strict consensus tree was generated from the equally most-parsimonious trees. Bootstrap values were computed using 1000 replicates with MEGA (Kumar et al., 2004
) to evaluate support for the branches.
Compared evolution of NADP-MDH genes in Andropogoneae
Within Andropogoneae, two NADP-MDH genes were identified (NMDH-I and NMDH-II; see below). Using all available sequences, amino acid sites providing a distinction between these two genes were investigated. A segment of 350 amino acids was used. In the Sorghum NMDH-I protein (429 amino acids; X53453
[GenBank]
), this segment is situated between amino acids 70 and 419. In addition, in order to determine possible selective divergence between the two NADP-MDH genes, the rates of non-synonymous and synonymous substitutions between pairs of sequences from S. officinarum, S. bicolor and Vetiveria zizanioides were compared independently for NMDH-I and NMDH-II. The method of Nei and Gojobori (1986)
was applied.
Within Andropogoneae, the occurrence of episodic positive selection following gene duplication was also tested on the 1050 bp segment. Eleven sequence accessions from Saccharum, Sorghum, Vetiveria, Zea and Oryza were considered (M31965
[GenBank]
, S55884
[GenBank]
, X16084
[GenBank]
, X53453
[GenBank]
, AJ344432
[GenBank]
, AJ344433
[GenBank]
, AJ416567
[GenBank]
, AJ512374
[GenBank]
, AJ512375
[GenBank]
, AJ565857
[GenBank]
and AK105935
[GenBank]
). The AJ565856
[GenBank]
accession was not used in this analysis since it probably encodes a non-functional enzyme (see below). Furthermore, in the genus Saccharum, only one NMDH-I sequence (AJ565857
[GenBank]
) was used because accessions AJ565857
[GenBank]
and AJ833960
[GenBank]
only differ by one non-synonymous substitution. The structure of the phylogenetic tree was defined based on an MP analysis as previously described. The dN/dS ratios (
) were estimated for all branches of the tree by using a maximum likelihood (ML) analysis as described by Yang (1998)
. We used the CODEML program implemented in the PAML package (Yang, 1997
) using the free ratio model assuming an independent dN/dS ratio for each branch of the phylogenetic tree (Yang, 1998
). The F3X4 codon model was used; it takes into account differences in transversion vs. transition and codon usages between analysed sequences.
NADP-MDH gene transcription analysis in Andropogoneae
To quantify differential NADP-MDH RNA accumulation between different plant materials (i.e. green leaf, etiolated leaf, root and stem) in S. officinarum, we used a Northern dot-blot membrane (see Besnard et al., 2003
). For each tissue sample of cultivar R570, 10 mg of total RNA was directly located onto an N+-Hybond nylon membrane (Amersham, Bucks, UK). An NADP-MDH segment of 357 bp (accession AJ320266
[GenBank]
) was hybridized as a probe using the procedure described in Besnard et al. (2003)
. In Saccharum, this probe displays great similarity (at least 94 %) with both genes NMDH-I and NMDH-II. Consequently, this probe cannot be considered as specific to one NADP-MDH gene. The membrane was also independently hybridized with a ribosomal 18S probe. Ribosomal 18S gene expression was considered to be constitutive and proportional to the amount of deposited RNA. The light induction of the NADP-MDH transcription was estimated using the relative signal intensity of 18S and NADP-MDH genes on the Northern dot-blot for both green and etiolated leaves.
A semi-quantitative PCR approach was developed to compare transcript accumulation of NMDH-I and NMDH-II in green leaves of Saccharum, Sorghum and Vetiveria. One accession each for S. arundinaceum and V. zizanioides and three for S. officinarum accessions [i.e. SES14 (wild accession), Big Tana Rayé and R570 (cultivated accessions)] were characterized. Several restriction sites allowing distinction between NMDH-I and NMDH-II were identified. One primer pair was defined to amplify simultaneously an internal cds region of 253 bp of both NADP-MDH genes containing a diagnostic HpaII restriction site: For-5' GCCCTTCTTATTGGTGCTAAG 3' and Rev-5' CTAGCTGGCACTTTGCTCTAT 3'. PCR mixtures, containing 0·25 mM dNTP, 10 mM TrisHCl (pH 8·3), 1·5 mM MgCl2 and 20 pmol of each oligonucleotide primer in a total volume of 50 µL, were added to 0·3 mg of cDNA and 1·2 U of Taq DNA polymerase (Advanced Biotechnologies, Inc., Columbia, MD, USA) and amplified in a thermocycler (PTC100-v7, MJ Research). Samples were incubated for 4 min at 94 °C, followed by 36 cycles consisting of 45 s at 94 °C, 45 s at 50 °C and 45 s at 72 °C. This PCR program was followed by steps of decreasing temperature from 94 to 50 °C on the basis of 3 min per degree, to avoid heteroduplex formation. A 10 µL aliquot of PCR product was then restricted with HpaII (Sigma-Aldrich Corp., Missouri, USA) following the supplier's recommendations. Restriction fragments were separated on a 3 % agarose gel and stained with ethidium bromide. The gels were photographed using a Kodak DC290 digital camera. Photo treatment for a relative quantification of NMDH-I or NMDH-II mRNA of each gene was carried out using the Kodak 1D Image analyser software (version 3·6). A correction was made between the ethidium bromide staining intensity and the size of the fragments [253 bp for the unrestricted fragment (NMDH-I) and 220 bp for the restricted fragment (NMDH-II)]. To test the reproducibility of the method, three independent assays were performed.
| RESULTS |
|---|
|
|
|---|
Data sequences and phylogenetic relationships between NADP-MDH
Nineteen 19 cDNA sequences encoding NADP-MDHs were generated in the species analysed (Table 1). One sequence from S. spontaneum (AJ565856 [GenBank] ) probably corresponds to a pseudo-gene due to the presence of a termination codon in the middle of the sequence. The phylogenetic trees based on the sequence analysis of the 1050 bp segment are presented in Fig. 1. The different methods used to reconstruct phylogenies led to similar results. Oryza, as expected with this level of sampling, is sister to Panicoideae. In a non-monophyletic tribe Paniceae, Paspalum is separated from Paspalidium, Melinis, Urochloa and Oplismenus, although with only weak bootstrap support. Paspalum is sister to Andropogoneae in the MP tree, whereas it is sister to the rest of the Panicoideae in the NJ tree. Lastly, phylogenetic reconstruction shows that the clade including all NADP-MDHs from Andropogoneae is well supported (>98 %; Fig. 1). Nevertheless, in this clade, two groups of sequences can be recognized (named NMDH-I and NMDH-II; Fig. 1B). In each of these two sub-clades, there is at least one sequence from Saccharum, Sorghum and Vetiveria. The sequence of Zea is not clearly assignable to either of these two sub-clades.
|
Evolution of NADP-MDH genes in Andropogoneae
The comparison of mutation rates between the same species for each NADP-MDH gene revealed that the ratio
(dN/dS) is 1·32·0 times higher in NMDH-II than in NMDH-I (Table 2). This suggests that the evolution of NMDH-II was slightly faster than that of NMDH-I. Using an ML analysis to estimate the dN/dS ratios along phylogenetic branches, a value >1·0 was obtained at the base of the NMDH-II clade (
= 1·60; Fig. 2). This probably indicates an episodic positive selection on the NMDH-II gene. Within the 350 amino acid sequence, three sites allow a distinction between NMDH-I and NMDH-II. First, at position 329 (in the sorghum sequence X53453
[GenBank]
), NMDH-I proteins have an alanine whereas all NMDH-II proteins have a valine. The other sequences from Paniceae, Zea and Oryza also have a valine. (This modification is a conservative mutation that should not induce a major change in the enzyme characteristics.) Secondly, at position 292 (in X53453
[GenBank]
), a lysine is found in proteins belonging to NMDH-I in Paniceae, Zea and Oryza, whereas a glutamine or a glutamate is found in NMDH-II proteins. Thirdly, at position 414, an asparagine is found in all proteins belonging to NMDH-I in Paniceae, Zea and Oryza, whereas an aspartate is found in NMDH-II proteins.
|
|
Comparative NADP-MDH gene transcription in Andropogoneae
Using a Northern dot-blot approach, higher NADP-MDH gene transcription was revealed in green leaves of sugarcane cultivar R570 (Fig 3A) than in roots, stem and etiolated leaves. This confirms that the transcription of NADP-MDH genes is light induced in Saccharum. It was estimated that the transcript accumulation was about seven times higher in green leaves than in etiolated leaves. Using the semi-quantitative PCR method, it was revealed that both NADP-MDH genes are transcribed in green leaves of Saccharum, Sorghum and Vetiveria (Fig. 3B), and it was shown that the amount of cDNA was usually higher for NMDH-I than for NMDH-II. However, similar amounts of cDNA were observed for both genes in cultivar R570 (54 and 46 %; Fig. 3B).
|
| DISCUSSION |
|---|
|
|
|---|
The phylogenetic trees based on NADP-MDH sequences (Fig. 1) allow a distinction to be made between a paraphyletic Paniceae and a monophyletic Andropogoneae in sub-family Panicoideae. The separation of Paspalum from other Paniceae analysed (Paspalidium, Melinis, Urochloa and Oplismenus; Fig. 1B) was expected since paraphyly in this tribe has been demonstrated using other gene sequences (e.g. Giussani et al., 2001
Theoretical models predict that maintenance of duplicate genes could be associated with selective pressures via neo-functionalization, in which one copy acquires a new function, or by sub-functionalization, in which the original function is partitioned across both copies (Monson, 2003
; Walsh, 2003
). Gene duplication and subsequent modifications are considered to be essential for the multiple C4 pathway appearance. Many of the duplicated genes destined for C4 roles should have been shaped by selection to produce novel C3 roles, prior to being recruited for C4 photosynthesis (Monson, 2003
). However, the C4 NADP-MDH isoform selection could be a relatively simple event compared with the selection of other C4 genes (e.g. C4 PEPC genes) since it may not always have involved gene duplication (McGonigle and Nelson, 1995
; Monson, 2003
). As proposed by McGonigle and Nelson (1995)
, NADP-MDH enzymes involved in C4 photosynthesis have been selected for their high expression level in the mesophyll cells (as is probably the case in Zea in which only one NADP-MDH gene has been identified). Nevertheless, selective pressures favouring new mutations during the evolution from C3 to C4 NADP-MDH are likely to have occurred. Gene duplication should thus be an opportunity to partition the original functions of NADP-MDHs across different copies. In S. bicolor, NMDH-I was reported to have a high transcription level in green leaves and is likely to be involved in C4 photosynthesis, whereas NMDH-II, which displays a lower transcription level, could be involved in the reducing equivalent export (Luchetta et al., 1991
). Our results (Fig. 3) confirm that the transcript accumulation in green leaves is usually stronger for NMDH-I than for NMDH-II, sustaining the hypothesis that these two genes were maintained in some Andropogoneae due to sub-functionalization. Furthermore, we expect that each isoform displays different kinetic properties since positive selection has probably occurred during the period of time following the duplication event (on the basal branch of the NMDH-II clade; Fig. 2). In this way, two amino acid sites (Lys292 and Asn414 in sorghum NMDH-I) were detected which could induce significant differences in kinetic properties between NMDH-I and NMDH-II. Different electric properties of the amino acids at these variable sites should result in conformational changes between NMDH-I and NMDH-II. To assess the importance of such sites, additional studies are needed. For example, experiments could be done using site-directed mutagenesis (Schepens et al., 2000
) or by construction of reciprocal enzyme chimeras (Bläsing et al., 2000
), offering new perspectives for biochemical research on the NADP-MDH enzymes (Miginiac-Maslow et al., 2000
).
| ACKNOWLEDGEMENTS |
|---|
|
|
|---|
We would like to thank Trevor Hodkinson, Gerald Edwards and Mike Fay for their constructive suggestions. We are also grateful for helpful discussions with J. P. Jacquot, N. Corradi, C. Parisod and B. Offmann.
| LITERATURE CITED |
|---|
|
|
|---|
-
Besnard G, Offmann B, Robert C, Rouch C, Cadet F. 2002. Assessment of the C4 phosphoenolpyruvate carboxylase gene diversity in grasses (Poaceae). Theoretical and Applied Genetics 105: 404412.[CrossRef]
Besnard G, Pinçon G, D'Hont A, Hoarau JY, Cadet F, Offmann B. 2003. Characterisation of the phosphoenolpyruvate carboxylase gene family in sugarcane (Saccharum spp.). Theoretical and Applied Genetics 107: 470478.[CrossRef]
Bläsing OE, Westhoff P, Svensson P. 2000. Evolution of C4 phosphoenolpyruvate carboxylase in Flaveria: a conserved serine residue in the carboxyl-terminal part of the enzyme is a major determinant for C4-specific characteristics. Journal of Biological Chemistry 275: 2791727923.
von Caemmerer S, Furbank RT. 2003. The C4 pathway: an efficient CO2 pump. Photosynthesis Research 77: 191207.[CrossRef][Web of Science][Medline]
Dillon SL, Lawrence PK, Henry R. 2001. The use of ribosomal ITS to determine phylogenetic relationships within Sorghum. Plant Systematics and Evolution 230: 97110.[CrossRef]
Duvall MR, Saar DE, Grayburn WS, Holbrook GP. 2003. Complex transitions between C3 and C4 photosynthesis during the evolution of Paniceae: a phylogenetic case study emphasizing the position of Steinchisma hians (Poaceae), a C3C4 intermediate. International Journal of Plant Sciences 164: 949658.[CrossRef]
Edwards GE, Furbank RT, Hatch MD, Osmond CB. 2001. What does it take to be C4? Lessons from the evolution of C4 photosynthesis. Plant Physiology 125: 4649.
Gehrig H, Heute V, Kluge M. 2001. New partial sequences of phosphoenolpyruvate carboxylase as molecular phylogenetic markers. Molecular Phylogenetics and Evolution 20: 262274.[CrossRef][Web of Science][Medline]
Giussani LM, Cota-Sanchez JH, Zuloaga FO, Kellogg EA. 2001. A molecular phylogeny of the grass subfamily Panicoideae (Poaceae) shows multiple origins of C4 photosynthesis. American Journal of Botany 88: 19932012.
GPWG. 2001. Phylogeny and subfamilial classification of the grasses (Poaceae). Annals of the Missouri Botanical Garden 88: 373457.[CrossRef][Web of Science]
Hodkinson TR, Chase MW, Lledó D, Salamin N, Renvoize SA. 2002. Phylogenetics of Miscanthus, Saccharum and related genera (Saccharinae, Andropogoneae, Poaceae) based on DNA sequences from ITS nuclear ribosomal DNA and plastid trnL intron and trnL-F intergenic spacers. Journal of Plant Research 115: 381392.[CrossRef][Web of Science][Medline]
Kellogg EA. 2000. The grasses: a case study in macroevolution. Annual Review of Ecology and Systematics 31: 217238.[CrossRef][Web of Science]
Kikuchi S, Satoh K, Nagata T, Kawagashira N, Doi K, Kishimoto N, et al. 2003. Collection, mapping and annotation of over 28,000 cDNA clones from japonica rice. Science 301: 376379.
Kimura M. 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111120.[CrossRef][Web of Science][Medline]
Kumar S, Tamura K, Nei M. 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings in Bioinformatics 5: 150163.
Luchetta P, Crétin C, Gadal P. 1991. Organization and expression of the two homologous genes encoding the NADP-malate dehydrogenase in Sorghum vulgare leaves. Molecular and General Genetics 228: 473481.
McGonigle B, Nelson T. 1995. C4 isoform of NADP-malate dehydrogenase: cDNA cloning and expression in leaves of C4, C3, and C3C4 intermediate species of Flaveria. Plant Physiology 108: 11191126.[Abstract]
Matsuoka M, Furbank RT, Fukayama H, Miyao M. 2001. Molecular engineering of C4 photosynthesis. Annual Review of Plant Physiology and Plant Molecular Biology 52: 297314.[CrossRef][Web of Science][Medline]
Metzler MC, Rothermel BA, Nelson T. 1989. Maize NADP-malate dehydrogenase: cDNA cloning, sequence, and mRNA characterization. Plant Molecular Biology 12: 713722.[CrossRef]
Miginiac-Maslow M, Johansson K, Ruelland E, Issakidis-Bourguet E, Schepens I, Goyer A, et al. 2000. Light-activation of NADP-malate dehydrogenase: a highly controlled process for an optimized function. Physiologia Plantarum 110: 322329.[CrossRef]
Monson RK. 2003. Gene duplication, neofunctionalization, and the evolution of C4 photosynthesis. International Journal of Plant Sciences 164: S43S54.[CrossRef]
Nei M, Gojobori T. 1986. Simple methods for estimating the number of synonymous and nonsynonymous nucleotide substitutions. Molecular Biology and Evolution 3: 418426.[Abstract]
Ocheretina O, Haferkamp I, Tellioglu H, Scheibe R. 2000. Light-modulated NADP-malate dehydrogenases from mossfern and green algae: insights into evolution of the enzyme's regulation. Gene 258: 147154.[CrossRef][Web of Science][Medline]
Sage RF. 2004. The evolution of C4 photosynthesis. New Phytologist 161: 341370.[CrossRef][Web of Science]
Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406425.[Abstract]
Scheibe R. 1987. NADP-malate dehydrogenase in C3 plants: regulation and role of light-activated enzyme. Physiologia Plantarum 71: 393400.[CrossRef]
Schepens I, Ruelland E, Miginiac-Maslow M, Le Maréchal P, Decottignies P. 2000. The role of active site arginines of sorghum NADP-malate dehydrogenase in thioredoxin-dependent activation and activity. Journal of Biological Chemistry 275: 3579235798.
Sheen J. 1999. C4 gene expression. Annual Review of Plant Physiology and Plant Molecular Biology 50: 187271.[CrossRef][Web of Science]
Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalities and weight matrix choice. Nucleic Acids Research 22: 46734680.
Walsh B. 2003. Population-genetics models of the fates of duplicate genes. Genetica 118: 279294.[CrossRef][Web of Science][Medline]
Westhoff P, Gowik U. 2004. Evolution of C4 phosphoenolpyruvate carboxylase. Genes and proteins: a case study with the genus Flaveria. Annals of Botany 94: 1323.
Yang Z. 1997. PAML, a program package for phylogenetic analysis by maximum likelihood. Computer Applications in the Biosciences 13: 555556.
Yang Z. 1998. Likelihood ratio tests for detecting positive selection and application to primate lysozyme evolution. Molecular Biology and Evolution 15: 568573.[Abstract]
This article has been cited by other articles:
![]() |
P.-A. Christin, B. Petitpierre, N. Salamin, L. Buchi, and G. Besnard Evolution of C4 Phosphoenolpyruvate Carboxykinase in Grasses, from Genotype to Phenotype Mol. Biol. Evol., February 1, 2009; 26(2): 357 - 365. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Vaughan, E. Balazs, and J. S. Heslop-Harrison From Crop Domestication to Super-domestication Ann. Bot., October 1, 2007; 100(5): 893 - 901. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




